OPENSEQ.org - 1501094728 - GREMLIN Submission

May 4, 2021 - We are working on upgrading the webserver, some pages may not work.

mix1 -force run

ID:	1501094728	Query Sequence TTAAAACAGCTCTGGGGTTGTTCCCACCCCAGAGGCCCACGTGGCGGCTAGTACACTGGTATCACGGTACCTTTGTACGCCGPGFDYAVAMAKRNIVTATTSKGEFTMLGVHDNVAVLPTHASPGETIVVDGKEVEVLDAKALEDQAGTNLEITIVTLKRSEKFRDIRPHIPTQITETNDGVLIVNTSKYPNMYVPVGAVTEQGYLNLGGRQTARTLMYNFPTRAGQCGGIITCTGKVIGMHVGGNGSHGFAAALKRSYFTQNQ	Download Alignment We filter this alignment to remove positions that have > 50% gaps before running GREMLIN.
Length:	264 (187)
Sequences:	196 (104.5)
Seq/Len:	1.048
Nf(neff/√len):	7.6

Jackhmmer Results: (2016_04)
Sequences per length for each position, BEFORE the coverage/gap filter was applied

Legend: Dots above the red line, indicates positions where there is > 5 sequences per length (if visible, green bar = 20 seq/len). Point of this graphic is to give you an idea if resubmitting a sub-portion of your sequence might help increase the overall Seq/Len (which after applying the coverage filter is at: 1.048).

Sequences per length for each position, AFTER the coverage/gap filter was applied

Legend: If visible, the positions blocked in grey are regions that have > 50% gaps and were automatically trimmed and excluded in the GREMLIN analysis.

GREMLIN Results:
Residue pairs sorted by coevolution strength:

Legend: The darker and larger the blue dots, the higher strength in covariance. Below we provide the list of the top [1.5 x length] covarying residues with sequence seperation > 3. The i and j are positions as given in the input sequence.

i	j	Scaled score	Prob
240_G	252_A	2.803	1.00
219_Y	242_H	1.973	0.95
112_H	168_R	1.800	0.92
173_T	257_R	1.722	0.89
156_V	241_M	1.687	0.88
100_T	132_G	1.638	0.86
216_T	243_V	1.609	0.84
119_P	230_G	1.581	0.83
223_T	242_H	1.574	0.82
108_M	116_A	1.536	0.80
171_I	255_L	1.524	0.79
120_T	153_I	1.516	0.79
85_F	89_V	1.505	0.78
128_I	136_E	1.480	0.77
148_G	169_P	1.433	0.73
186_N	190_Y	1.413	0.72
119_P	208_L	1.403	0.71
138_L	159_K	1.387	0.70
166_D	223_T	1.379	0.69
84_G	234_C	1.371	0.69
148_G	243_V	1.365	0.68
78_C	94_R	1.355	0.67
92_A	232_I	1.335	0.66
113_D	163_K	1.325	0.65
242_H	247_G	1.320	0.64
256_K	259_Y	1.316	0.64
98_T	105_E	1.311	0.63
111_V	241_M	1.288	0.61
110_G	164_F	1.286	0.61
79_G	85_F	1.269	0.60
78_C	85_F	1.258	0.59
168_R	171_I	1.257	0.59
197_V	204_G	1.252	0.58
107_T	135_V	1.234	0.57
193_M	233_T	1.232	0.56
172_P	191_P	1.229	0.56
223_T	227_Q	1.221	0.55
87_Y	170_H	1.199	0.53
99_A	153_I	1.197	0.53
230_G	247_G	1.196	0.53
137_V	143_L	1.183	0.52
78_C	141_K	1.179	0.51
204_G	253_A	1.179	0.51
213_T	253_A	1.176	0.51
148_G	216_T	1.176	0.51
117_V	241_M	1.173	0.51
119_P	243_V	1.172	0.51
162_E	250_G	1.169	0.50
152_E	244_G	1.167	0.50
197_V	213_T	1.142	0.48
151_L	164_F	1.138	0.48
153_I	200_V	1.132	0.47
219_Y	250_G	1.132	0.47
108_M	233_T	1.130	0.47
93_K	102_S	1.130	0.47
156_V	198_G	1.129	0.47
79_G	160_R	1.128	0.47
153_I	238_V	1.126	0.46
114_N	163_K	1.122	0.46
219_Y	223_T	1.118	0.46
80_C	92_A	1.115	0.45
125_G	137_V	1.114	0.45
85_F	94_R	1.113	0.45
186_N	199_A	1.108	0.45
179_N	182_V	1.105	0.44
209_G	221_F	1.105	0.44
153_I	205_Y	1.103	0.44
204_G	208_L	1.101	0.44
196_P	237_K	1.100	0.44
99_A	108_M	1.095	0.44
80_C	262_Q	1.093	0.43
95_N	111_V	1.093	0.43
221_F	244_G	1.091	0.43
230_G	244_G	1.089	0.43
90_A	97_V	1.086	0.43
79_G	100_T	1.080	0.42
130_V	174_Q	1.079	0.42
107_T	185_V	1.077	0.42
161_S	243_V	1.075	0.42
194_Y	237_K	1.069	0.41
180_D	196_P	1.068	0.41
159_K	236_G	1.058	0.40
181_G	234_C	1.057	0.40
116_A	164_F	1.055	0.40
111_V	114_N	1.055	0.40
242_H	245_G	1.054	0.40
156_V	166_D	1.051	0.40
119_P	152_E	1.047	0.39
78_C	116_A	1.042	0.39
113_D	232_I	1.041	0.39
152_E	166_D	1.041	0.39
170_H	183_L	1.040	0.39
160_R	195_V	1.040	0.39
213_T	246_N	1.037	0.38
187_T	225_A	1.032	0.38
232_I	262_Q	1.031	0.38
100_T	263_N	1.031	0.38
109_L	242_H	1.023	0.37
90_A	98_T	1.022	0.37
235_T	246_N	1.021	0.37
84_G	97_V	1.018	0.37
100_T	103_K	1.014	0.36
110_G	122_A	1.014	0.36
85_F	92_A	1.012	0.36
208_L	215_R	1.006	0.36
165_R	227_Q	1.003	0.35
114_N	119_P	1.001	0.35

Legend: Only predictions with Scaled Score > 1 are listed. For all 3L/2 predictions, click on one of the links below.
Prob = P(contact | scaled_score, seq/len).
Scaled Score = (raw_score/average(raw_scores)).

Text file of contact predictions (all 3L/2 predictions)
Generate restraints for ROSETTA Structure Modeling

NEW Features

Import to GREMLIN BETA - features includes ability to upload PDB and latest P(contact) calculation based on eLife 2015 fitting to PDB data.

HHsearch Results: (06Aug15)
GREMLIN results overlayed on top 10 PDB hits:

Legend: Blue filled circles are GREMLIN results (Scaled Score > 1). The grey/red filled circles underneath are pdb residue contacts (min distance < 5 Angstroms). The shade of the circles is based on 10 HHsearch results which uses the overall probability and per-position alignment confidence. Inter oligomeric contacts in the pdb are in shades of red.

PDB	M	Cov	P(%)	HHΔ
3q3yA	2	0.6856	100	0.471	Contact Map
3qzrA	2	0.6818	100	0.478	Contact Map
1cqqA	1	0.6818	100	0.491	Contact Map
2b0fA	1	0.6894	100	0.501	Contact Map
3zveA	1	0.6932	100	0.509	Contact Map
2ijd1	2	0.6932	100	0.511	Contact Map
4dcdA	1	0.697	100	0.556	Contact Map
2bhgA	2	0.6553	100	0.584	Contact Map
2halA	1	0.6667	100	0.646	Contact Map
1lvmA	2	0.7045	99.3	0.87	Contact Map

M = number of chains, if homo-oligomer
Cov = coverage of hit
P(%) = probability

Sequence Conservation (Image Generated using WebLogo v3)

Legend: Color is used to show Hydrophobicity (Blue: Hydrophilic, Green: Neutral and Black: Hydrophobic). Amount of gaps is represented by width.

Page generated in 1.4817 seconds.